B28: cdh5-CatCh-IRES-lacZ Strain Information Sheet
Strain Name:
Common Name: cdh5-CatCh-IRES-lacZ
CHROMusTM designation and lines available: R24:B28
Jackson Stock number: Jax# 033345
Development: The rhodopsin based effector, CatCh was inserted at the ATG site of the cdh5 gene in the BAC RP23-453P1 (CHORI) through homologous recombination. The resulting recombinant BAC was injected into the male pronucleus of fertilized oocytes which were then implanted into pseudo pregnant females. Resulting offspring were screened for the presence of the transgene (founders). Colonies were established from each founder and tested for expression.
Transgenic Numbers:
# pups born | # founders | # expressors |
13 | 4 | 2 |
Description: The rhodopsin based effector, CatCh is expressed under control of the cdh5 promoter, directing expression to endothelial cells. Expression is observed in endothelial cells of vessels. An internal ribosome entry site (IRES) allows for co-expression of lacZ as a visual indicator of expression patterns. This mouse is useful for activating endothelial cells.
Phenotypic Data:
Functional analysis is ongoing. LacZ staining of heart, brain and lung shows appropriate expression patterns.
Genotyping Protocol:
Primer B107 | GGAGATCTATGTGTGCGCTATC |
Primer B108 | CCAGCAGTTCTTCGACATCA |
Expected size of product: | 535bp |
Cycling conditions:
|
PCR results: |
Terms of Use: Please contact chromus@cornell.edu for information on MTA and fees.
So as to appropriately acknowledge and credit the scientists who have produced the cdh5-CatCh-IRES-lacZ mouse strain, it is expected that you will include these individuals in any publication that is submitted prior to the initial publication of this line from the Kotlikoff laboratory.
Acknowledgement: Please inform us of any publications resulting from the use of this mouse and use the following statement to acknowledge their development:
The mouse strain cdh5-CatCh-IRES-lacZ was developed by CHROMusTM which is supported by the National Heart Lung Blood Institute of the National Institute of Health under award number R24HL120847.